bbs i restriction enzymes (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
bbs i restriction enzymes
Bbs I Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 662 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbs+i+hf/BbsI+HF/pmc13674509-238-10-14
Average 99 stars, based on 662 article reviews
Bbs I Restriction Enzymes, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 662 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/bbs+i+hf/BbsI+HF/pmc13674509-238-10-14
Average 99 stars, based on 662 article reviews
bbs i restriction enzymes - by Bioz Stars,
2026-11
99/100 stars
Images
Related Articles
other:Article Title: A harmless-to-harmful switchable and spatiotemporally activated nano-CRISPR hierarchically amplifies ferroptosis in melanoma Article Snippet: Purification:Article Title: Generation of cloned sheep lacking galactose-α1,3-galactose and N-glycolylneuraminic acid antigens Article Snippet: .. Briefly, PX459 was digested with Article Title: A next-generation dual guide CRISPR system for genetic interaction library screening Article Snippet: .. 5 μg lentiviral guide expression vector pKLV2-U6gRNA5(BbsI)PGKpuro-2A-BFP-W (Addgene #67974) was linearised with 100 U of Article Title: A next-generation dual guide CRISPR system for genetic interaction library screening. Article Snippet: Oligo pools were synthesized by Twist Bioscience, resuspended in TE buffer (10 mM Tris-HCl, pH8.0, 0.1 mM EDTA) and amplified by PCR with Kapa HiFi Hotstart in 50 μl reactions with 1 ng library (10 ng for pilot library) using primers (IDT Ultramers, LibAmpF - ATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAA ACACC LibAmpR - TGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCT TAAAC) and 14 cycles (Denaturation 95°C 3min, 98°C 20s, 71°C 15s, 72°C 30s, final extension 72°C 60s). .. 5μg lentiviral guide expression vector pKLV2-U6gRNA5(BbsI)PGKpuro-2ABFP-W (Addgene #67974) was linearised with 100 U of Agarose Gel Electrophoresis:Article Title: Generation of cloned sheep lacking galactose-α1,3-galactose and N-glycolylneuraminic acid antigens Article Snippet: .. Briefly, PX459 was digested with Article Title: A next-generation dual guide CRISPR system for genetic interaction library screening Article Snippet: .. 5 μg lentiviral guide expression vector pKLV2-U6gRNA5(BbsI)PGKpuro-2A-BFP-W (Addgene #67974) was linearised with 100 U of Article Title: A next-generation dual guide CRISPR system for genetic interaction library screening. Article Snippet: Oligo pools were synthesized by Twist Bioscience, resuspended in TE buffer (10 mM Tris-HCl, pH8.0, 0.1 mM EDTA) and amplified by PCR with Kapa HiFi Hotstart in 50 μl reactions with 1 ng library (10 ng for pilot library) using primers (IDT Ultramers, LibAmpF - ATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAA ACACC LibAmpR - TGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCT TAAAC) and 14 cycles (Denaturation 95°C 3min, 98°C 20s, 71°C 15s, 72°C 30s, final extension 72°C 60s). .. 5μg lentiviral guide expression vector pKLV2-U6gRNA5(BbsI)PGKpuro-2ABFP-W (Addgene #67974) was linearised with 100 U of Isolation:Article Title: Generation of cloned sheep lacking galactose-α1,3-galactose and N-glycolylneuraminic acid antigens Article Snippet: .. Briefly, PX459 was digested with Expressing:Article Title: A next-generation dual guide CRISPR system for genetic interaction library screening Article Snippet: .. 5 μg lentiviral guide expression vector pKLV2-U6gRNA5(BbsI)PGKpuro-2A-BFP-W (Addgene #67974) was linearised with 100 U of Article Title: A next-generation dual guide CRISPR system for genetic interaction library screening. Article Snippet: Oligo pools were synthesized by Twist Bioscience, resuspended in TE buffer (10 mM Tris-HCl, pH8.0, 0.1 mM EDTA) and amplified by PCR with Kapa HiFi Hotstart in 50 μl reactions with 1 ng library (10 ng for pilot library) using primers (IDT Ultramers, LibAmpF - ATCATATGCTTACCGTAACTTGAAAGTATTTCGATTTCTTGGCTTTATATATCTTGTGGAAAGGACGAA ACACC LibAmpR - TGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTAAACTTGCTATGCTGTTTCCAGCATAGCTCT TAAAC) and 14 cycles (Denaturation 95°C 3min, 98°C 20s, 71°C 15s, 72°C 30s, final extension 72°C 60s). .. 5μg lentiviral guide expression vector pKLV2-U6gRNA5(BbsI)PGKpuro-2ABFP-W (Addgene #67974) was linearised with 100 U of Ligation:Article Title: A modular synthetic biology toolkit unlocks metabolic engineering of the industrially relevant alga Nannochloropsis Article Snippet: Primers for PCR molecular cloning or annealing were commercially synthesized by Tsingke Biotechnology (Dataset S2). .. Restriction enzyme digestion of plasmids was performed using Plasmid Preparation:Article Title: Parallelization of single-molecule binding kinetic measurements via protein barcode sequencing Article Snippet: .. The vector pPBC Halo and synthetic gene fragments encoding GFP with an N-terminal dye-cycling peptide sequence (either RLFA, FAQR or LARQ) separated by a GGGS linker, and C-terminal 2x FLAG tag (Extended Data 3a) were digested with Sequencing:Article Title: Parallelization of single-molecule binding kinetic measurements via protein barcode sequencing Article Snippet: .. The vector pPBC Halo and synthetic gene fragments encoding GFP with an N-terminal dye-cycling peptide sequence (either RLFA, FAQR or LARQ) separated by a GGGS linker, and C-terminal 2x FLAG tag (Extended Data 3a) were digested with FLAG-tag:Article Title: Parallelization of single-molecule binding kinetic measurements via protein barcode sequencing Article Snippet: .. The vector pPBC Halo and synthetic gene fragments encoding GFP with an N-terminal dye-cycling peptide sequence (either RLFA, FAQR or LARQ) separated by a GGGS linker, and C-terminal 2x FLAG tag (Extended Data 3a) were digested with |